Facebook
Twitter
LinkedIn
Email
 |
Checking for direct PDF access through Ovid | |
Excerpt
The CD8 T lymphocyte non-cytotoxic antiviral response (CNAR) plays an important role in maintaining a healthy clinical state in HIV-infected individuals [1–3] and by preventing the transmission of HIV [4]. CNAR is mediated, at least partly, by a CD8 cell antiviral factor (CAF) which is present in CD8 T cell culture supernatants [5]. CAF is a small molecular weight protein that is unrelated to known cytokines or chemokines [5], and inhibits the replication of HIV by blocking HIV transcription [6].
CNAR or CAF may block HIV transcription by preventing transcription factors such as nuclear factor kappa B (NF-κB) from binding to the promoter region of the long terminal repeat (LTR) [7]. To test this hypothesis, we compared the ability of CNAR and CAF to suppress a mutant SIV mac239 isolate, which lacks the NF-κB and Spl binding elements (SIVmac239/T1). The mutant SIVmac239/T1 replicates efficiently in peripheral blood mononuclear cells (PBMC) and T cell lines [8], and induces AIDS in rhesus macaques [9]. The identities of the SIV isolates were confirmed by directly sequencing the LTR regions after polymerase chain reaction amplification. The primers were: for the NF-κB wild-type SIV ATGTGAGGGGACTTTCCCAGGC (forward), for the T1 mutant ATGTGAAGCTCACTTTCCCA GGC (forward), and for both, TACACTCCCCCTGAAGGGTCCG (reverse). The sequencing showed a 10 base-pair deletion of the NF-κB and Spl binding sites in the LTR region.
In undertaking this study, PBMC were prepared using Ficoll-hypaque separation from healthy HIV-1-infected individuals who have been infected for more than 10 years (long-term survivors, LTS). The cells were stimulated using phytohemagglutinin (3 μg/ml), and CD8 T lymphocytes were then purified from the PBMC using magnetic bead separation (Dynal, Lake Success, NY, USA). CD4 cells from normal healthy donors were purified using immunomagnetic beads and acutely infected with the wild-type or mutant SIV strains as described [1]. The CD8 T cells were added to the SIV-infected CD4 T cells at cell ratios ranging from 2 : 1 to 0.5 : 1 [1]. In two separate experiments, we found that the non-cytotoxic CD8 T lymphocyte antiviral response controlled the replication of both the SIVmac239/T1 and the wild-type parental strain, SIVmac239, to a similar extent (Table 1). Virus replication was suppressed by approximately 90% at a CD8 to CD4 cell ratio of 1 : 1 as measured by reverse transcriptase (RT) activity in the culture supernatant [10]. The control subject (13911, a seronegative individual) did not suppress virus replication.
We next sought to determine if CD8 cell culture fluids containing CAF [5,11] could suppress both SIVmac239/T1 and SIVmac239 production. The CD8 cell fluid was mixed 1 : 1 with culture medium and added to the virus-infected CD4 cells 1 h after virus inoculation [11]. Cultures were maintained with medium and CD8 cell culture fluid changes every 2 days. Virus replication was measured by the RT assay [10]. The CAF-containing culture fluid suppressed replication of SIVmac239/T1 and SIVmac239 by 65.7 and 57.4%, respectively, compared with the virus production (2 × 106 cpm/ml) by the infected CD4 cells that received control medium. The same CAF-containing fluid suppressed replication of a standard HIV-1 strain (SF2) by 51% (Table 1).
