Three novel : 2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patientsHBB: 2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2: 2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

    loading  Checking for direct PDF access through Ovid

Abstract

Abstract unavailable for this article.

Related Topics

    loading  Loading Related Articles